Information

What exactly happens if during translation, an amino acid is not present?

What exactly happens if during translation, an amino acid is not present?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Lets say that the cell wants to make a particular protein. Transcription of the appropriate gene is done and the mRNA is made. mRNA attaches to the ribosome and the translation is initiated in a "normal" way.

What exactly would happen if an amino acid required in the protein is absent ? I know that the protein would not be manufactured properly but I want to exactly know what would happen to the ribosome and the mRNA. Are they destroyed? Are they simply separated? Who regulates this?


It is not true that the anticodon of an uncharged tRNA can't bind to the mRNA.

Bacteria have a mechanism called stringent response. This response is complicated, here is a shorter and simplified explanation. Further informations can be found at the wikipedia pages linked in the text.

If during translation a certain amino acid is absent, an uncharged tRNA binds in the ribosome, causing the synthesis of the alarmone (p)ppGpp by activation of the RelA enzyme (in E. coli), associated with the 50S subunity of the ribosome. The translation blocks and (p)ppGpp interacts with β subunit of RNApol causing:

  1. the reduction of its affinity for the σ70 transcription factor and therefore reducing the transcription of rRNA genes;
  2. the increase of its affinity for σS and σN, transcription factors needed, rispectively, for the adaptation at the stationary phase and the lack of N. Also biosynthesis of amino acids is enhanced.

Once the situation is restored, the enzyme SpoT (coli) hydrolizes (p)ppGpp.


Point to know : aminoacyl-tRNA binds to mRNA its not just t-RNA…

So if there is no Amino-acid there is no aminoacyl-tRNA of that aminoacid… so if there is no aminoacyl-tRNA, the anticodon of tRNA doesn't form a bond with mRNA, so the protein production halts (until the Amino acid produced).

If the protein is not formed within a certain long time, the premature protein folds itself and breaks. Then a molecule (example: ubiquitin for certain type of bacteria) attaches to this premature protein and marks it for degradation.

But there are still chances of protein production with slight mutations.

Mutation: tRNA with the same anticodon and different aminoacid can easily bind to the A site of the ribosome in the absence of the correct aminoacyl-tRNA, so the protein production doesn't stop in this case but the protein has a mutation with different aminoacid.


What exactly happens if during translation, an amino acid is not present? - Biology

Figure 1. A peptide bond links the carboxyl end of one amino acid with the amino end of another, expelling one water molecule. For simplicity in this image, only the functional groups involved in the peptide bond are shown. The R and R′ designations refer to the rest of each amino acid structure.

The process of translation, or protein synthesis, involves the decoding of an mRNA message into a polypeptide product. Amino acids are covalently strung together by interlinking peptide bonds . Each individual amino acid has an amino group (NH2) and a carboxyl (COOH) group. Polypeptides are formed when the amino group of one amino acid forms an amide (i.e., peptide) bond with the carboxyl group of another amino acid (Figure 1).

This reaction is catalyzed by ribosomes and generates one water molecule.


Transfer RNA

Transfer RNA plays a huge role in protein synthesis and translation. Its job is to translate the message within the nucleotide sequence of mRNA to a specific amino acid sequence. These sequences are joined together to form a protein. Transfer RNA is shaped like a clover leaf with three loops. It contains an amino acid attachment site on one end and a special section in the middle loop called the anticodon site. The anticodon recognizes a specific area on a mRNA called a codon.


Elongation

The ribosome has two tRNA binding sites the P site which holds the p eptide chain and the A site which a ccepts the tRNA.

While Methionine-tRNA occupies the P site, the aminoacyl-tRNA that is complementary to the next codon binds to the A site, using energy yielded from the hydrolysis of GTP.

Methionine moves from the P site to the A site to bond to new amino acid there, and so the growth of the peptide has begun. The tRNA molecule in the P site no longer has an attached amino acid, and so leaves the ribosome.

The ribosome then translocates along the mRNA molecule to the next codon, again using energy yielded from the hydrolysis of GTP. Now, the growing peptide lies at the P site and the A site is open for the binding of the next aminoacyl-tRNA, and the cycle continues. The polypeptide chain is built up in the direction from the N terminal (methionine) to the C terminal (the final amino acid).

Figure 4 – Elongation of the polypeptide chain


RNA vs. DNA

It’s tempting to confuse RNA with DNA, but they’re very different, and it’s important to understand these differences. They are both made up of nucleotides, which are the basic units of nucleic acids (like DNA and RNA). These nucleotides contain a phosphate group, a nitrogenous base, and a 5-carbon sugar ribose.

Instead of DNA’s ribose, however, RNA uses deoxyribose, a different kind of sugar. Also, RNA is most often a single strand, while DNA is famously double-stranded. Finally, DNA contains thymine, while RNA uses uracil instead.


Biology 171

By the end of this section, you will be able to do the following:

  • Describe the different steps in protein synthesis
  • Discuss the role of ribosomes in protein synthesis

The synthesis of proteins consumes more of a cell’s energy than any other metabolic process. In turn, proteins account for more mass than any other component of living organisms (with the exception of water), and proteins perform virtually every function of a cell. The process of translation, or protein synthesis, involves the decoding of an mRNA message into a polypeptide product. Amino acids are covalently strung together by interlinking peptide bonds in lengths ranging from approximately 50 to more than 1000 amino acid residues. Each individual amino acid has an amino group (NH2) and a carboxyl (COOH) group. Polypeptides are formed when the amino group of one amino acid forms an amide (i.e., peptide) bond with the carboxyl group of another amino acid ((Figure)). This reaction is catalyzed by ribosomes and generates one water molecule.

The Protein Synthesis Machinery

In addition to the mRNA template, many molecules and macromolecules contribute to the process of translation. The composition of each component may vary across species for example, ribosomes may consist of different numbers of rRNAs and polypeptides depending on the organism. However, the general structures and functions of the protein synthesis machinery are comparable from bacteria to human cells. Translation requires the input of an mRNA template, ribosomes, tRNAs, and various enzymatic factors. (Note: A ribosome can be thought of as an enzyme whose amino acid binding sites are specified by mRNA.)

Click through DNA Workshop: Protein Synthesis (webpage) to see protein synthesis in action.

Ribosomes

Even before an mRNA is translated, a cell must invest energy to build each of its ribosomes. In E. coli, there are between 10,000 and 70,000 ribosomes present in each cell at any given time. A ribosome is a complex macromolecule composed of structural and catalytic rRNAs, and many distinct polypeptides. In eukaryotes, the nucleolus is completely specialized for the synthesis and assembly of rRNAs.

Ribosomes exist in the cytoplasm of prokaryotes and in the cytoplasm and rough endoplasmic reticulum of eukaryotes. Mitochondria and chloroplasts also have their own ribosomes in the matrix and stroma, which look more similar to prokaryotic ribosomes (and have similar drug sensitivities) than the ribosomes just outside their outer membranes in the cytoplasm. Ribosomes dissociate into large and small subunits when they are not synthesizing proteins and reassociate during the initiation of translation. In E. coli, the small subunit is described as 30S, and the large subunit is 50S, for a total of 70S (recall that Svedberg units are not additive). Mammalian ribosomes have a small 40S subunit and a large 60S subunit, for a total of 80S. The small subunit is responsible for binding the mRNA template, whereas the large subunit sequentially binds tRNAs. Each mRNA molecule is simultaneously translated by many ribosomes, all synthesizing protein in the same direction: reading the mRNA from 5′ to 3′ and synthesizing the polypeptide from the N terminus to the C terminus. The complete mRNA/poly-ribosome structure is called a polysome .

TRNAs

The tRNAs are structural RNA molecules that were transcribed from genes by RNA polymerase III. Depending on the species, 40 to 60 types of tRNAs exist in the cytoplasm. Transfer RNAs serve as adaptor molecules. Each tRNA carries a specific amino acid and recognizes one or more of the mRNA codons that define the order of amino acids in a protein. Aminoacyl-tRNAs bind to the ribosome and add the corresponding amino acid to the polypeptide chain. Therefore, tRNAs are the molecules that actually “translate” the language of RNA into the language of proteins.

Of the 64 possible mRNA codons—or triplet combinations of A, U, G, and C—three specify the termination of protein synthesis and 61 specify the addition of amino acids to the polypeptide chain. Of these 61, one codon (AUG) also encodes the initiation of translation. Each tRNA anticodon can base pair with one or more of the mRNA codons for its amino acid. For instance, if the sequence CUA occurred on an mRNA template in the proper reading frame, it would bind a leucine tRNA expressing the complementary sequence, GAU. The ability of some tRNAs to match more than one codon is what gives the genetic code its blocky structure.

As the adaptor molecules of translation, it is surprising that tRNAs can fit so much specificity into such a small package. Consider that tRNAs need to interact with three factors: 1) they must be recognized by the correct aminoacyl synthetase (see below) 2) they must be recognized by ribosomes and 3) they must bind to the correct sequence in mRNA.

Aminoacyl tRNA Synthetases

The process of pre-tRNA synthesis by RNA polymerase III only creates the RNA portion of the adaptor molecule. The corresponding amino acid must be added later, once the tRNA is processed and exported to the cytoplasm. Through the process of tRNA “charging,” each tRNA molecule is linked to its correct amino acid by one of a group of enzymes called aminoacyl tRNA synthetases . At least one type of aminoacyl tRNA synthetase exists for each of the 20 amino acids the exact number of aminoacyl tRNA synthetases varies by species. These enzymes first bind and hydrolyze ATP to catalyze a high-energy bond between an amino acid and adenosine monophosphate (AMP) a pyrophosphate molecule is expelled in this reaction. The activated amino acid is then transferred to the tRNA, and AMP is released. The term “charging” is appropriate, since the high-energy bond that attaches an amino acid to its tRNA is later used to drive the formation of the peptide bond. Each tRNA is named for its amino acid.

The Mechanism of Protein Synthesis

As with mRNA synthesis, protein synthesis can be divided into three phases: initiation, elongation, and termination. The process of translation is similar in prokaryotes and eukaryotes. Here we’ll explore how translation occurs in E. coli, a representative prokaryote, and specify any differences between prokaryotic and eukaryotic translation.

Initiation of Translation

Protein synthesis begins with the formation of an initiation complex . In E. coli, this complex involves the small 30S ribosome, the mRNA template, three initiation factors (IFs IF-1, IF-2, and IF-3), and a special initiator tRNA , called tRNA Metf .

In E. coli mRNA, a sequence upstream of the first AUG codon, called the Shine-Dalgarno sequence (AGGAGG), interacts with the rRNA molecules that compose the ribosome. This interaction anchors the 30S ribosomal subunit at the correct location on the mRNA template. Guanosine triphosphate (GTP), which is a purine nucleotide triphosphate, acts as an energy source during translation—both at the start of elongation and during the ribosome’s translocation. Binding of the mRNA to the 30S ribosome also requires IF-III.

The initiator tRNA then interacts with the start codon AUG (or rarely, GUG). This tRNA carries the amino acid methionine, which is formylated after its attachment to the tRNA. The formylation creates a “faux” peptide bond between the formyl carboxyl group and the amino group of the methionine. Binding of the fMet-tRNA Metf is mediated by the initiation factor IF-2. The fMet begins every polypeptide chain synthesized by E. coli, but it is usually removed after translation is complete. When an in-frame AUG is encountered during translation elongation, a non-formylated methionine is inserted by a regular Met-tRNA Met . After the formation of the initiation complex, the 30S ribosomal subunit is joined by the 50S subunit to form the translation complex. In eukaryotes, a similar initiation complex forms, comprising mRNA, the 40S small ribosomal subunit, eukaryotic IFs, and nucleoside triphosphates (GTP and ATP). The methionine on the charged initiator tRNA, called Met-tRNAi, is not formylated. However, Met-tRNAi is distinct from other Met-tRNAs in that it can bind IFs.

Instead of depositing at the Shine-Dalgarno sequence, the eukaryotic initiation complex recognizes the 7-methylguanosine cap at the 5′ end of the mRNA. A cap-binding protein (CBP) and several other IFs assist the movement of the ribosome to the 5′ cap. Once at the cap, the initiation complex tracks along the mRNA in the 5′ to 3′ direction, searching for the AUG start codon. Many eukaryotic mRNAs are translated from the first AUG, but this is not always the case. According to Kozak’s rules , the nucleotides around the AUG indicate whether it is the correct start codon. Kozak’s rules state that the following consensus sequence must appear around the AUG of vertebrate genes: 5′-gccRccAUGG-3′. The R (for purine) indicates a site that can be either A or G, but cannot be C or U. Essentially, the closer the sequence is to this consensus, the higher the efficiency of translation.

Once the appropriate AUG is identified, the other proteins and CBP dissociate, and the 60S subunit binds to the complex of Met-tRNAi, mRNA, and the 40S subunit. This step completes the initiation of translation in eukaryotes.

Translation, Elongation, and Termination

In prokaryotes and eukaryotes, the basics of elongation are the same, so we will review elongation from the perspective of E. coli. When the translation complex is formed, the tRNA binding region of the ribosome consists of three compartments. The A (aminoacyl) site binds incoming charged aminoacyl tRNAs. The P (peptidyl) site binds charged tRNAs carrying amino acids that have formed peptide bonds with the growing polypeptide chain but have not yet dissociated from their corresponding tRNA. The E (exit) site releases dissociated tRNAs so that they can be recharged with free amino acids. The initiating methionyl-tRNA, however, occupies the P site at the beginning of the elongation phase of translation in both prokaryotes and eukaryotes.

During translation elongation, the mRNA template provides tRNA binding specificity. As the ribosome moves along the mRNA, each mRNA codon comes into register, and specific binding with the corresponding charged tRNA anticodon is ensured. If mRNA were not present in the elongation complex, the ribosome would bind tRNAs nonspecifically and randomly (?).

Elongation proceeds with charged tRNAs sequentially entering and leaving the ribosome as each new amino acid is added to the polypeptide chain. Movement of a tRNA from A to P to E site is induced by conformational changes that advance the ribosome by three bases in the 3′ direction. The energy for each step along the ribosome is donated by elongation factors that hydrolyze GTP. GTP energy is required both for the binding of a new aminoacyl-tRNA to the A site and for its translocation to the P site after formation of the peptide bond. Peptide bonds form between the amino group of the amino acid attached to the A-site tRNA and the carboxyl group of the amino acid attached to the P-site tRNA. The formation of each peptide bond is catalyzed by peptidyl transferase , an RNA-based enzyme that is integrated into the 50S ribosomal subunit. The energy for each peptide bond formation is derived from the high-energy bond linking each amino acid to its tRNA. After peptide bond formation, the A-site tRNA that now holds the growing peptide chain moves to the P site, and the P-site tRNA that is now empty moves to the E site and is expelled from the ribosome ((Figure)). Amazingly, the E. coli translation apparatus takes only 0.05 seconds to add each amino acid, meaning that a 200-amino-acid protein can be translated in just 10 seconds.

Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?

Tetracycline would directly affect:

Chloramphenicol would directly affect:

Termination of translation occurs when a nonsense codon (UAA, UAG, or UGA) is encountered. Upon aligning with the A site, these nonsense codons are recognized by protein release factors that resemble tRNAs. The releasing factors in both prokaryotes and eukaryotes instruct peptidyl transferase to add a water molecule to the carboxyl end of the P-site amino acid. This reaction forces the P-site amino acid to detach from its tRNA, and the newly made protein is released. The small and large ribosomal subunits dissociate from the mRNA and from each other they are recruited almost immediately into another translation initiation complex. After many ribosomes have completed translation, the mRNA is degraded so the nucleotides can be reused in another transcription reaction.

Protein Folding, Modification, and Targeting

During and after translation, individual amino acids may be chemically modified, signal sequences appended, and the new protein “folded” into a distinct three-dimensional structure as a result of intramolecular interactions. A signal sequence is a short sequence at the amino end of a protein that directs it to a specific cellular compartment. These sequences can be thought of as the protein’s “train ticket” to its ultimate destination, and are recognized by signal-recognition proteins that act as conductors. For instance, a specific signal sequence terminus will direct a protein to the mitochondria or chloroplasts (in plants). Once the protein reaches its cellular destination, the signal sequence is usually clipped off.

Many proteins fold spontaneously, but some proteins require helper molecules, called chaperones, to prevent them from aggregating during the complicated process of folding. Even if a protein is properly specified by its corresponding mRNA, it could take on a completely dysfunctional shape if abnormal temperature or pH conditions prevent it from folding correctly.

Section Summary

The players in translation include the mRNA template, ribosomes, tRNAs, and various enzymatic factors. The small ribosomal subunit binds to the mRNA template either at the Shine-Dalgarno sequence (prokaryotes) or the 5′ cap (eukaryotes). Translation begins at the initiating AUG on the mRNA, specifying methionine. The formation of peptide bonds occurs between sequential amino acids matched to the mRNA template by their tRNAs according to the genetic code. Charged tRNAs enter the ribosomal A site, and their amino acid bonds with the amino acid at the P site. The entire mRNA is translated in three-nucleotide “steps” of the ribosome. When a nonsense codon is encountered, a release factor binds and dissociates the components and frees the new protein. Folding of the protein occurs during and after translation.

Art Connections

(Figure) Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?

Tetracycline would directly affect:

Chloramphenicol would directly affect

(Figure) Tetracycline: a Chloramphenicol: c.

Free Response

Transcribe and translate the following DNA sequence (nontemplate strand): 5′-ATGGCCGGTTATTAAGCA-3′

The mRNA would be: 5′-AUGGCCGGUUAUUAAGCA-3′. The protein would be: MAGY. Even though there are six codons, the fifth codon corresponds to a stop, so the sixth codon would not be translated.

Explain how single nucleotide changes can have vastly different effects on protein function.

Nucleotide changes in the third position of codons may not change the amino acid and would have no effect on the protein. Other nucleotide changes that change important amino acids or create or delete start or stop codons would have severe effects on the amino acid sequence of the protein.

A normal mRNA that reads 5’ – UGCCAUGGUAAUAACACAUGAGGCCUGAAC– 3’ has an insertion mutation that changes the sequence to 5’ -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC– 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)

Original mRNA: 5’ –UGCC AUG GUA AUA ACA CAU GAG GCC UGA AC– 3’

Translation: Met – Val – Ile – Thr – His – Glu – Ala

Mutated mRNA: 5’ –UGCC AUG GUU AAU AAC ACA UGA GGCCUGAAC– 3’

Translation: Met – Val – Asn – Asn – Thr

Insertion mutations can have dramatic effects on proteins because they shift the reading frame for the codons. This changes the amino acids encoded by the mRNA, and can introduce premature start or stop sites.

Glossary

aminoacyl tRNA synthetase enzyme that “charges” tRNA molecules by catalyzing a bond between the tRNA and a corresponding amino acid initiator tRNA in prokaryotes, called in eukaryotes, called tRNAi a tRNA that interacts with a start codon, binds directly to the ribosome P site, and links to a special methionine to begin a polypeptide chain Kozak’s rules determines the correct initiation AUG in a eukaryotic mRNA the following consensus sequence must appear around the AUG: 5’-GCC(purine)CCAUGG-3’ the bolded bases are most important peptidyl transferase RNA-based enzyme that is integrated into the 50S ribosomal subunit and catalyzes the formation of peptide bonds polysome mRNA molecule simultaneously being translated by many ribosomes all going in the same direction Shine-Dalgarno sequence (AGGAGG) initiates prokaryotic translation by interacting with rRNA molecules comprising the 30S ribosome signal sequence short tail of amino acids that directs a protein to a specific cellular compartment start codon AUG (or rarely, GUG) on an mRNA from which translation begins always specifies methionine

Open Reading Frame

Once the start codon is identified, each sequential group of three base pairs form the next codon. In this way the position of the start codon determines the open reading frame, or order of codons that will be read to form the protein. In the example below, once the ribosome assembles on the first AUG, the order of the rest of the codons is set for the rest of the translation of the mRNA.


Genetic Code and Amino Acid Translation

Table 1 shows the genetic code of the messenger ribonucleic acid (mRNA), i.e. it shows all 64 possible combinations of codons composed of three nucleotide bases (tri-nucleotide units) that specify amino acids during protein assembling.

Each codon of the deoxyribonucleic acid (DNA) codes for or specifies a single amino acid and each nucleotide unit consists of a phosphate, deoxyribose sugar and one of the 4 nitrogenous nucleotide bases, adenine (A), guanine (G), cytosine (C) and thymine (T). The bases are paired and joined together by hydrogen bonds in the double helix of the DNA. mRNA corresponds to DNA (i.e. the sequence of nucleotides is the same in both chains) except that in RNA, thymine (T) is replaced by uracil (U), and the deoxyribose is substituted by ribose.

The process of translation of genetic information into the assembling of a protein requires first mRNA, which is read 5' to 3' (exactly as DNA), and then transfer ribonucleic acid (tRNA), which is read 3' to 5'. tRNA is the taxi that translates the information on the ribosome into an amino acid chain or polypeptide.

For mRNA there are 4 3 = 64 different nucleotide combinations possible with a triplet codon of three nucleotides. All 64 possible combinations are shown in Table 1. However, not all 64 codons of the genetic code specify a single amino acid during translation. The reason is that in humans only 20 amino acids (except selenocysteine) are involved in translation. Therefore, one amino acid can be encoded by more than one mRNA codon-triplet. Arginine and leucine are encoded by 6 triplets, isoleucine by 3, methionine and tryptophan by 1, and all other amino acids by 4 or 2 codons. The redundant codons are typically different at the 3rd base. Table 2 shows the inverse codon assignment, i.e. which codon specifies which of the 20 standard amino acids involved in translation.

Table 1. Genetic code: mRNA codon -> amino acid

1st
Base
2nd
Base
3rd
Base
U C A G
U Phenylalanine Serine Tyrosine Cysteine U
Phenylalanine Serine Tyrosine Cysteine C
Leucine Serine Stop Stop A
Leucine Serine Stop Tryptophan G
C Leucine Proline Histidine Arginine U
Leucine Proline Histidine Arginine C
Leucine Proline Glutamine Arginine A
Leucine Proline Glutamine Arginine G
A Isoleucine Threonine Asparagine Serine U
Isoleucine Threonine Asparagine Serine C
Isoleucine Threonine Lysine Arginine A
Methionine (Start) 1 Threonine Lysine Arginine G
G Valine Alanine Aspartate Glycine U
Valine Alanine Aspartate Glycine C
Valine Alanine Glutamate Glycine A
Valine Alanine Glutamate Glycine G

Table 2. Reverse codon table: amino acid -> mRNA codon

Amino acid mRNA codons Amino acid mRNA codons
Ala/A GCU, GCC, GCA, GCG Leu/L UUA, UUG, CUU, CUC, CUA, CUG
Arg/R CGU, CGC, CGA, CGG, AGA, AGG Lys/K AAA, AAG
Asn/N AAU, AAC Met/M AUG
Asp/D GAU, GAC Phe/F UUU, UUC
Cys/C UGU, UGC Pro/P CCU, CCC, CCA, CCG
Gln/Q CAA, CAG Ser/S UCU, UCC, UCA, UCG, AGU, AGC
Glu/E GAA, GAG Thr/T ACU, ACC, ACA, ACG
Gly/G GGU, GGC, GGA, GGG Trp/W UGG
His/H CAU, CAC Tyr/Y UAU, UAC
Ile/I AUU, AUC, AUA Val/V GUU, GUC, GUA, GUG
START AUG STOP UAG, UGA, UAA

The direction of reading mRNA is 5' to 3'. tRNA (reading 3' to 5') has anticodons complementary to the codons in mRNA and can be "charged" covalently with amino acids at their 3' terminal. According to Crick the binding of the base-pairs between the mRNA codon and the tRNA anticodon takes place only at the 1st and 2nd base. The binding at the 3rd base (i.e. at the 5' end of the tRNA anticodon) is weaker and can result in different pairs. For the binding between codon and anticodon to come true the bases must wobble out of their positions at the ribosome. Therefore, base-pairs are sometimes called wobble-pairs.

Table 3 shows the possible wobble-pairs at the 1st, 2nd and 3rd base. The possible pair combinations at the 1st and 2nd base are identical. At the 3rd base (i.e. at the 3' end of mRNA and 5' end of tRNA) the possible pair combinations are less unambiguous, which leads to the redundancy in mRNA. The deamination (removal of the amino group NH2) of adenosine (not to confuse with adenine) produces the nucleotide inosine (I) on tRNA, which generates non-standard wobble-pairs with U, C or A (but not with G) on mRNA. Inosine may occur at the 3rd base of tRNA.

Table 3. Base-pairs: mRNA codon -> tRNA anticodon

Table 3 is read in the following way: for the 1st and 2nd base-pairs the wobble-pairs provide uniqueness in the way that U on tRNA always emerges from A on mRNA, A on tRNA always emerges from U on mRNA, etc. For the 3rd base-pair the genetic code is redundant in the way that U on tRNA can emerge from A or G on mRNA, G on tRNA can emerge from U or C on mRNA and I on tRNA can emerge from U, C or A on mRNA. Only A and C at the 3rd place on tRNA are unambiguously assigned to U and G at the 3rd place on mRNA, respectively.

Due to this combination structure a tRNA can bind to different mRNA codons where synonymous or redundant mRNA codons differ at the 3rd base (i.e. at the 5' end of tRNA and the 3' end of mRNA). By this logic the minimum number of tRNA anticodons necessary to encode all amino acids reduces to 31 (excluding the 2 STOP codons AUU and ACU, see Table 5). This means that any tRNA anticodon can be encoded by one or more different mRNA codons (Table 4). However, there are more than 31 tRNA anticodons possible for the translation of all 64 mRNA codons. For example, serine has a fourfold degenerate site at the 3rd position (UCU, UCC, UCA, UCG), which can be translated by AGI (for UCU, UCC and UCA) and AGC on tRNA (for UCG) but also by AGG and AGU. This means, in turn, that any mRNA codon can also be translated by one or more tRNA anticodons (see Table 5).

The reason for the occurrence of different wobble-pairs encoding the same amino acid may be due to a compromise between velocity and safety in protein synthesis. The redundancy of mRNA codons exist to prevent mistakes in transcription caused by mutations or variations at the 3rd position but also at other positions. For example, the first position of the leucine codons (UCA, UCC, CCU, CCC, CCA, CCG) is a twofold degenerate site, while the second position is unambiguous (not redundant). Another example is serine with mRNA codons UCA, UCG, UCC, UCU, AGU, AGC. Of course, serine is also twofold degenerate at the first position and fourfold degenerate at the third position, but it is twofold degenerate at the second position in addition. Table 4 shows the assignment of mRNA codons to any possible tRNA anticodon in eukaryotes for the 20 standard amino acids involved in translation. It is the reverse codon assignment.

Table 4. Reverse amino acid encoding: amino acid -> tRNA anticodon -> mRNA codon

While it is not possible to predict a specific DNA codon from an amino acid, DNA codons can be decoded unambiguously into amino acids. The reason is that there are 61 different DNA (and mRNA) codons specifying only 20 amino acids. Note that there are 3 additional codons for chain termination, i.e. there are 64 DNA (and thus 64 different mRNA) codons, but only 61 of them specify amino acids.

Table 5 shows the genetic code for the translation of all 64 DNA codons, starting from DNA over mRNA and tRNA to amino acid. In the last column, the table shows the different tRNA anticodons minimally necessary to translate all DNA codons into amino acids and sums up the number in the final row. It reveals that the minimum number of tRNA anticodons to translate all DNA codons is 31 (plus 2 STOP codons). The maximum number of tRNA anticodons that can emerge in amino acid transcription is 70 (plus 3 STOP codons).

Table 5. Genetic code: DNA -> mRNA codon -> tRNA anticodon -> amino acid

Note:
1 The codon AUG both codes for methionine and serves as an initiation site: the first AUG in an mRNA's coding region is where translation into protein begins.


Protein Synthesis Made Easy in 26 Q&As

The characteristics of organisms depend on the chemical reactions that occur inside them. These reactions are catalyzed by enzymes, which are highly specific proteins. Every protein of an organism is made from information contained in RNA molecules, which are made according to a template based on a sequence of nucleotides of a DNA chain.

A gene is a DNA polynucleotide sequence that contains information for the production of a protein.

RNA and Ribosomes

4. What is the role of messenger RNA and ribosomes in protein synthesis?

Messenger RNA (mRNA) is produced within the nucleus of a cell and migrates to the cytoplasm, where it attaches to ribosomes and guides the building of the amino acid sequences that will compose proteins. Ribosomes are sites for the meeting and binding of mRNA and transfer RNA (tRNA). They are the structures where amino acids transported by tRNA are united by peptide bonds to form polypeptide chains (proteins).

5. What subunits make up ribosomes?

Ribosomes are made of two subunits, the small subunit and the large subunit. These subunits are made of ribosomal RNA (rRNA) and proteins. Ribosomes have three binding sites, one for mRNA and two for tRNA.

6. How different is the location of ribosomes in eukaryotic and in prokaryotic cells?

In prokaryotes, ribosomes are found free in cytoplasm. In eukaryotic cells, they can also be found free in cytoplasm, but are mainly attached to the external membrane of the karyotheca and the rough endoplasmic reticulum.

7. How is the presence of ribosomes inside mitochondria and chloroplasts explained?

A well-supported hypothesis states that mitochondria and chloroplasts were prokaryotes that developed a relationship of mutualism with eukaryotic cells (gaining protection and offering energy). This explains why these organelles contain DNA and protein synthesis machinery, including ribosomes. This hypothesis is known as the endosymbiotic hypothesis on the origin of mitochondria and chloroplasts.

8. What are some examples of human cells that produce proteins for exportation? Which cytoplasmic organelle must be well-developed and abundant in those cells?

Specialized cells of glands, such as the Langerhans cells of the pancreas (which produce insulin) or saliva-producing cells, are examples of secretory cells. In cells specialized in secretion, the endoplasmic reticulum and the Golgi apparatus are well-developed, since they participate in the storage and processing of proteins for exportation.

9. Which ribosomes are the more abundant in secretory cells, the ribosomes free in the cytoplasm or those attached to the rough endoplasmic reticulum?

The ribosomes free in the cytoplasm are more related to protein production for internal cellular consumption whereas those attached to the rough endoplasmic reticulum are more important in protein synthesis for exportation. Proteins made by attached ribosomes enter the rough endoplasmic reticulum and are later transferred to the Golgi apparatus. Therefore, in secretory cells, ribosomes attached to the endoplasmic reticulum are more abundable.

Select any question to share it on FB or Twitter

Just select (or double-click) a question to share. Challenge your Facebook and Twitter friends.

Messenger RNA and Protein Translation

10. Where in eukaryotic cells does mRNA synthesis occur? Where do these molecules migrate to?

Messenger RNA molecules are synthesized within the nucleus, pass through the pores of the nuclear membrane and enter the cytoplasm to reach the ribosomes where protein synthesis occurs.

11. Given that it is based on information from mRNA, what is the process of protein synthesis called?

Protein synthesis is called translation (of genetic information into proteins).

12. What is the difference between transcription and translation?

Transcription is the name given to the formation of RNA molecules from an open DNA chain used as a template. Translation is the creation of polypeptides (amino acids bound in sequence) and therefore of proteins based on information encoded in the mRNA molecule.

In eukaryotic cells, transcription occurs in the nucleus and translation occurs in ribosomes. Transcription precedes translation.

13. How do the nucleotides of mRNA chains encode information for the formation of the amino acids sequences of a protein?

There are only four types of nitrogenous bases that can compose RNA nucleotides: adenine (A), uracil (U), guanine (G) and cytosine (C). However, there are 20 different amino acids. With only one nucleotide (a 1:1 coding), it would be impossible to codify all the amino acids.

With two nucleotides, there would be an arrangement of 4 elements, 2 x 2, resulting in a total of only 16 possible codifier units (4 x 4). Nature may know combinatorial analysis, since it has created a genetic code by arranging the 4 RNA bases, 3 x 3, providing 64 different triplets (4 x 4 x 4).

Therefore, each triplet of nitrogenous bases of RNA codifies one amino acid of a protein. As these triplets appear in sequence in the RNA molecule, sequential amino acids codified by them are bound together to make polypeptide chains. For example, a UUU sequence codifies the amino acid phenylalanine, as well as the UUC sequence the ACU, ACC, ACA and ACG sequences codify the amino acid threonine and so on for all possible triplet sequences and all other amino acids.

14. What is the name of an RNA sequence that codifies one amino acid?

Each sequence of three nitrogenous bases of RNA that codifies one amino acid is called a codon. The codon is the codifier unit of the genetic code.

15. Given that out of the 64 codons of mRNA, 61 codify amino acids that form polypeptide chains, what are the functions of the three remaining codons?

Since there are 20 amino acids and 64 possibilities of mRNA codons, some amino acids codify more than one codon.

However, not all 64 codons however codify amino acids. Three of them, UAA, UGA and UAG, transmit the information that the last amino acid of the polypeptide chain has been bound, signaling the end of the polypeptide synthesis. These codons are called stop codons. The codon AUG codifies the amino acid methionine and, at the same time, it signals the beginning of the synthesis of a polypeptide chain (it is a start codon).

In prokaryotic cells, there is a sequence called the Shine-Dalgarno sequence (in general AGGAGG) in the position before the start codon AUG. The function of this sequence is to distinguish the start codon AUG and the other AUG codons of the RNA.

16. To which cellular structure do mRNA molecules bind to start protein synthesis?

To make proteins, mRNA molecules have to attach to ribosomes. Ribosomes have two sites for the binding of two neighboring mRNA codons and where anticodons of tRNA bind by hydrogen bond. Therefore, ribosomes are the structure responsible for the positioning and exposure of mRNA codons to be translated. In ribosomes the peptide bond between two amino acids brought by tRNA molecules also occurs. The peptide bond happens when tRNAs molecules carrying amino acids are bound to exposed mRNA codons.

17. How are amino acids brought to the sites of the cell where translation takes place? What is an anticodon?

Amino acids are brought to ribosomes by RNA molecules known as transfer RNA, or tRNA. One tRNA attached to its specific amino acid binds by a special sequence of three nucleotides to an mRNA codon exposed in the ribosome. This sequence in the tRNA is known as an anticodon. The tRNA anticodon must be complementary to the mRNA codon to which it binds, according to the rule A-U, C-G. The ribosome then slides along the mRNA molecule (a process called translocation) to expose the following codon for the binding of other tRNA. When amino acids corresponding to neighboring codons bind by peptide bond, the first tRNa molecule is released.

18. Why is the proximity between ribosomes and amino acids important for the formation of proteins? What is the enzyme that catalyzes that reaction?

The proximity between ribosomes and amino acids is important because the enzyme that catalyzes the peptide bond resides in ribosomes. As substrates of these enzymes, amino acids need to bind to the enzyme activation centers.

The enzyme that catalyzes the peptide bond is peptidyl transferase.

19. Why do ribosomes move along mRNA during translation?

During translation, the ribosome always exposes two mRNA codons to be translated by moving along the mRNA. When a peptide bond is made, the ribosome moves to expose the next codon. This movement is called ribosomal translocation. (In the rough endoplasmic reticulum, ribosomes are attached outside the membrane and mRNA molecules move through them).

20. How many of the same proteins are made at the same time by each ribosome during the translation of one mRNA molecule? How does consecutive protein production occur in translation?

Ribosomes do not make several different proteins simultaneously. They make them one after another.

However, many ribosomes may move along one mRNA molecule, mass manufacturing the same protein. The unit made of many ribosomes working on the same mRNA molecule is called a polysome.

Protein Synthesis - Image Diversity: polysome

21. Does an mRNA molecule codify only one type of protein?

Eukaryotic cells have monocistronic mRNA, meaning that each mRNA codifies only one polypeptide chain. Prokaryotes may present polycistronic mRNA.

After assembling amino acids into a polypeptide chain, the mRNA, through one of its stop codons, signals to the ribosome that the polypeptide is complete. The ribosome then releases the produced protein. In prokaryotes, after this process is finished, the information on the beginning of the synthesis of another different protein may follow in the same mRNA molecule.

22. If a tRNA anticodon is CAA, what is its corresponding mRNA codon? In the genetic code, which amino acid does this codon codify?

According to the A-U, C-G rule, the codon which corresponds to the CAA anticodon is GUU.

The genetic code table for translation is based on codons and not anticodons. The amino acid codified by GUU, according to the genetic code, is valine.

23. If a fragment of nucleic acid has a nucleotide sequence of TAC, is it a codon or an anticodon?

A nucleic acid fragment with a TAC sequence is surely not tRNA. It is DNA because RNA does not contain the nitrogenous base thymine. Since it is not RNA, it cannot be a codon or an anticodon.

The Universality of the Genetic Code

24. Why can the genetic code be called a “degenerate code”?

The genetic code is a degenerate code because some amino acids are codified by more than one type of codon. It is not a system in which each element is codified by only one codifying unit.

For example, the amino acid arginine is codified by six codons: CGU, CGC, CGA, CGG, AGA and AGG.

25. What is the concept of the universality of the genetic code? What are the exceptions to this universality?

The genetic code is universal because the rules of protein codification based on mRNA codons are practically the same for all known living organism. For example, the genetic code is the same for humans, bacteria and invertebrates.

however, protein synthesis in mitochondria, chloroplasts and some protozoa are accomplished through different genetic codification.

26. How does the universality of the genetic code make recombinant DNA technology possible?

The universality of the genetic code refers to the fact that the protein synthesis machinery of all living organisms function according to the same principles of storage, transmission and information recognition, including the translation of mRNA codons. This fact makes the exchanging of genes or gene fragments between different organisms possible and ensures that these genes continue to control protein synthesis.

This universality, for example, makes the insertion of a fragment of human DNA containing a gene for the production of a given protein into the genetic material of bacteria feasible. Since bacterial transcription and translation systems work in the same way as corresponding human systems, the bacteria will begin to synthesize the human protein associated with the inserted DNA fragment. There exist industries that produce human insulin (for use by diabetics) in this way, synthesized by bacteria with modified DNA. If the genetic code were not universal, this kind of genetic manipulation would be impossible or very difficult to accomplish without new technological advancements.

Now that you have finished studying Protein Synthesis, these are your options:


PROTEIN SYNTHESIS

During protein synthesis, mistakes in adding amino acids to the growing polypeptide chain are usually prevented. If they are not, a quality-control mechanism ensures premature termination of erroneous sequences.

For cells to flourish, the genetic code must be translated with great accuracy into the amino acids that proteins are made from. During translation, the cell’s protein-synthesis factory — the ribosome — carefully monitors the process by which new amino acids are added to a growing polypeptide chain. For each one, a specific trinucleotide (a codon) on messenger RNA is paired with a complementary anticodon on a transfer RNA, which at its other end carries the corresponding amino acid. Once codon𠄺nticodon pairs have formed, the amino acid is chemically linked to the polypeptide chain by a peptide bond. At this point, it was thought that the quality-control duties of the ribosome were more or less complete. But Zaher and Green 1 present evidence in this issue (page 161) that, even after peptide-bond formation, the ribosome can detect codon𠄺nticodon mismatches and reacts by bringing the protein’s synthesis to a premature end.

The matching of codons and anticodons by the ribosome is a tricky process, involving a certain amount of leeway (Watson𠄼rick wobble) to allow the reading of all 64 codons that make up the genetic code. So it is not surprising that, despite careful matchmaking, mistakes are sometimes made, resulting in misfolded or non-functional proteins that must be refolded or destroyed after translation is finished. During protein synthesis, mistakes are generally thought to occur at a rate of about 1 in every 20,000 amino acids, although levels can be higher or lower depending on the conditions 2 , 3 . Studies in different living systems support this estimated rate of error, whereas experiments with individual components of the protein-synthesis machinery in vitro have yielded less clear-cut results.

It was one such experiment that piqued Zaher and Green’s interest. When looking at the formation of simple two-amino-acid peptides, they sometimes saw error rates as high as 1 in 2,000 — an order of magnitude higher than they had expected. To further explore these high error rates, they turned to an occasional mistake that is well documented in living systems: the erroneous translation of the AAU codon into the amino acid lysine, rather than aspara gine. They also began to look at the formation of longer peptides of up to four amino acids. Much to their surprise, they found that, once a mistake has been made, the ribosome becomes much less efficient at adding amino acids. So rather than continuing to grow, the nascent peptide chain was released from the translational machinery prematurely.

Ribosomes contain three binding sites for their tRNA substrates: the aminoacyl (A) site, the peptidyl (P) site and the exit (E) site. During each round of amino-acid chain elongation, codon𠄺nticodon pairing allows entry of the correct tRNA into the A site ( Fig. 1a ). The nascent polypeptide chain bound to the tRNA at the P site is then transferred to the tRNA bearing a new amino acid at the A site, thereby lengthening the chain by one residue. This cycle of amino-acid addition is completed when the tRNA originally at the P site moves to the E site and the tRNA at the A site shifts to the P site, freeing up the A site for the next tRNA ( Fig. 1a ). The tRNA translocations are accompanied by mRNA movement by three nucleotides — or one codon — towards the E site. Iterative cycles of elongation occur until a stop codon, signalling the end, reaches the A site. Specific recognition of this codon by a primary release factor (known as RF proteins in the bacterium Escherichia coli) promotes hydrolysis of the now mature polypeptide from the P-site tRNA, a process called termination 4 .

a, Normally, the correct tRNA (yellow) enters the A site of the ribosome and the appropriate amino acid (red) is incorporated into the growing peptide chain, which transfers from tRNA in the P site to the tRNA at the A site. Both tRNAs, as well as the mRNA, then shift towards the E site. b, When mistakes are made and the mismatched codon𠄺nticodon helix (indicated by a red cross) translocates to the P site, the ribosomal complex becomes susceptible to premature termination by translation factors such as RF2, and the erroneous sequence is prematurely released.

In an effort to understand their puzzling observations, Zaher and Green 1 studied several defined ribosomal complexes, made from purified components, in vitro. They find that complexes containing a mismatch between the anticodon and codon in the P site are susceptible to RF2-mediated peptide release, despite the absence of a stop codon in the A site ( Fig. 1b ). Although slow, this reaction was stimulated considerably by the secondary release factor RF3, suggesting that it might be relevant in vivo, where both RFs are present.

Intriguingly, a sequence containing a mismatched codon𠄺nticodon pair in the P site also stimulated further error — that is, incorporation of an amino acid despite the absence of correct codon𠄺nticodon pairing 1 . Consequently, complexes containing codon𠄺nticodon mismatches were made in both the E and P sites. Again, the authors observed high rates of RF-dependent peptide release in these complexes, suggesting that termination can efficiently compete with elongation. The net effect is that miscoding errors terminate translation prematurely, which is another means of quality control by the ribosome — retrospectively, following peptide-bond formation — to increase the fraction of functional proteins made.

How codon𠄺nticodon mismatches in the P site (or P and E sites) stimulate further miscoding and peptide release remains unclear. Codon𠄺nticodon pairing in these sites normally helps to maintain the correct reading of codons on mRNA. Mismatches could disrupt such systematic reading of mRNA, potentially allowing various codons to transiently occupy the A site as the mRNA slides through the ribosome unpaired. Another possibility is that mismatches generate a conformational signal in the ribosomal complex that alters the activities of the translation factors such as RF proteins. Indeed, earlier work 5 - 7 showed that conformational changes in the ribosome regulate both the decoding of mRNA and its termination. Regardless of the precise mechanism involved, Zaher and Green’s work 1 reveals a facet of quality control in protein synthesis that depends on an unanticipated level of complexity in the workings of the ribosome.


What is a nonsense mutation?

Mutations can occur in the body for a variety of reasons, including the environment, ultraviolet light, or an error in the nucleotide sequence of the DNA molecule. A mutation that gives rise to a nonsense or stop codon in the mRNA transcript is called a nonsense mutation.

A nonsense mutation is a point mutation where a single nucleotide is replaced by another nucleotide. The new sequence codes for a stop signal, which causes the amino acid formation to stop prematurely. This releases a shortened protein that might function differently.

The tRNA translates any codon triplet without rectifying the previous mistake. In the case of a nonsense mutation, the nucleotide change always codes for a stop codon. The stop codons UAG, UGA or UAA signal the tRNA to halt protein synthesis and the protein will then be prematurely released from the t-RNA machinery. This shortened protein sequence may get degraded by the cell due to its untimely release and lack of appropriate function.

It is important to note that mutations occurring in the body are random and cannot be attributed to a single reason. Sometimes, mutations lead to variety in our DNA, while at other times the end product might be somewhat undesirable. Most often, the result of a nonsense mutation is a non-functional protein, but whatever the case may be, mutations help us appreciate the level of sophistication with which our DNA is made.